zondag 13 maart 2022

Pfizer vaccin tast DNA van de lever aan

Via het Linkedin account van Mario Ortiz Martinez vond ik de volgende productie waarin wordt uitgelegd dat het Pfizer vaccin het DNA van de lever aantast. Voorts wordt de Neurenberg Code aangehaald, waarin duidelijk is weergegeven dat het iedereen vrij moet staan om wel dan niet te kiezen voor een vaccinatie en gezien de tekst zit daar geen woord Spaans bij (overigens heeft de EU eerder laten weten tegen verpolichte vaccinatie te zijn, al is die mening intussen losgelaten door hare kwaadaardigheid von der Leyen, althans als ik me niet vergis):

"1. The voluntary consent of the human subject is absolutely essential. This means that the person involved should have legal capacity to give consent; should be so situated as to be able to exercise free power of choice, without the intervention of any element of force, fraud, deceit, duress, over-reaching, or other ulterior form of constraint or coercion."

Deze tekst kom je hieronder nogmaals tegen en gezien de volledige tekst is het m.i. onverantwoord om je te laten vaccineren met het Pfizer vaccin. Maar lees de tekst en vorm je eigen oordeel. (zie alvorens tot vaccinatie over te gaan ook de berichten onder de door mij toegevoegde links en ook daarbij: vorm je eigen mening)

(On the top right hand side of this page you can choose for a translation in the language of your choice: choose 'Engels' [english] so you can recognise your own language [the Google translation is first in dutch, a language most people don't understand, while on the other hand most people recognise there language translated in english])

(als je het Engels niet machtig bent, kopieer dan de Engelse tekst en plak die in deze vertaalapp, de app werkt snel en de vertaling is van een redelijk goede kwaliteit. Kopieer het artikel en plaats het links in de app, je ziet rechts Italiaans staan als je daar op klikt kan je kiezen voor Nederlands)

Drs. Mario Ortiz Martinez • Farma Medical-Marketing Projects, Medical & Farma 3D animation videos, Director Herr Zimmerman - Events & Music.

Peter J. Merrick • 3de+ Expert in Business Succession/Exiting Execution - Speaker - Author of The Business Novel - The King of Main Street

URGENT - BE IN FORMED - Please Read and Then Share with Loved Ones: Study shows Pfizer COVID shot changes the liver cells DNA according to Swedish researchers at Lund University - one of Europe's oldest and most prestigious research universities. These findings are published in the current -March 2022- Issue of the peer-reviewed journal - Molecular Biology.

***This first source full peer-reviewed article is included with this post below.***

ARTICLE ABSTRACT: These researchers found that messenger RNA (mRNA) from Pfizer’s COVID-19 gene therapy shot is able to enter human liver cells and convert into DNA- combining with the human genome - creating something - NEW - NEVER SEEN BEFORE!!!!!!

THIS IS CAUSE FOR ALARM - ARE HUMANS PATENABLE?

On June 13, 2013 - the US Supreme Court ruled that DNA manipulated by humans are eligible to be patented. This synthetic DNA is produced from messenger RNA that serves as the instructions for making proteins in the cell. Does this sound familiar? (i.e. – mRNA shots) - You can’t write this stuff up.

Again, please read and then share this document/article with as many people you care about as possible. Below in the comments a link to a down loadable pdf has been provided.

FOOD FOR THOUGHT:

WHAT IS INFORMED CONSENT - Point One of The Nuremberg Code - this is taken directly from United States National Institutes of Health:

"1. The voluntary consent of the human subject is absolutely essential. This means that the person involved should have legal capacity to give consent; should be so situated as to be able to exercise free power of choice, without the intervention of any element of force, fraud, deceit, duress, over-reaching, or other ulterior form of constraint or coercion."

Hier de productie van MDPI:

Intracellular Reverse Transcription of Pfizer BioNTech COVID-19 mRNA Vaccine BNT162b2 In Vitro in Human Liver Cell Line

Markus Aldén

Francisko Olofsson Falla

¹,

¹,

¹,

¹,

² and

^1,*

Department of Clinical Sciences, Lund University, 20502 Malmö, Sweden

Infection Medicine, Department of Clinical Sciences, Lund University, 22362 Lund, Sweden

Author to whom correspondence should be addressed.

Academic Editor: Stephen Malnick

Curr. Issues Mol. Biol. 2022, 44(3), 1115-1126; https://doi.org/10.3390/cimb44030073

Received: 18 January 2022 / Revised: 19 February 2022 / Accepted: 23 February 2022 / Published: 25 February 2022

(This article belongs to the Topic Clinical, Translational and Basic Research on Liver Diseases)

Download PDF

Browse Figures

Citation Export

Abstract

Preclinical studies of COVID-19 mRNA vaccine BNT162b2, developed by Pfizer and BioNTech, showed reversible hepatic effects in animals that received the BNT162b2 injection. Furthermore, a recent study showed that SARS-CoV-2 RNA can be reverse-transcribed and integrated into the genome of human cells. In this study, we investigated the effect of BNT162b2 on the human liver cell line Huh7 in vitro. Huh7 cells were exposed to BNT162b2, and quantitative PCR was performed on RNA extracted from the cells. We detected high levels of BNT162b2 in Huh7 cells and changes in gene expression of long interspersed nuclear element-1 (LINE-1), which is an endogenous reverse transcriptase. Immunohistochemistry using antibody binding to LINE-1 open reading frame-1 RNA-binding protein (ORFp1) on Huh7 cells treated with BNT162b2 indicated increased nucleus distribution of LINE-1. PCR on genomic DNA of Huh7 cells exposed to BNT162b2 amplified the DNA sequence unique to BNT162b2. Our results indicate a fast up-take of BNT162b2 into human liver cell line Huh7, leading to changes in LINE-1 expression and distribution. We also show that BNT162b2 mRNA is reverse transcribed intracellularly into DNA in as fast as 6 h upon BNT162b2 exposure.

Keywords: COVID-19 mRNA vaccine; BNT162b2; liver; reverse transcription; LINE-1; Huh7

1. Introduction

Coronavirus disease 2019 (COVID-19) caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) was announced by the World Health Organization (WHO) as a global pandemic on 11 March 2020, and it emerged as a devasting health crisis. As of February 2022, COVID-19 has led to over 430 million reported infection cases and 5.9 million deaths worldwide [1]. Effective and safe vaccines are urgently needed to reduce the morbidity and mortality rates associated with COVID-19.

Several vaccines for COVID-19 have been developed, with particular focus on mRNA vaccines (by Pfizer-BioNTech and Moderna), replication-defective recombinant adenoviral vector vaccines (by Janssen-Johnson and Johnson, Astra-Zeneca, Sputnik-V, and CanSino), and inactivated vaccines (by Sinopharm, Bharat Biotech and Sinovac). The mRNA vaccine has the advantages of being flexible and efficient in immunogen design and manufacturing, and currently, numerous vaccine candidates are in various stages of development and application. Specifically, COVID-19 mRNA vaccine BNT162b2 developed by Pfizer and BioNTech has been evaluated in successful clinical trials [2,3,4] and administered in national COVID-19 vaccination campaigns in different regions around the world [5,6,7,8].

BNT162b2 is a lipid nanoparticle (LNP)–encapsulated, nucleoside-modified RNA vaccine (modRNA) and encodes the full-length of SARS-CoV-2 spike (S) protein, modified by two proline mutations to ensure antigenically optimal pre-fusion conformation, which mimics the intact virus to elicit virus-neutralizing antibodies [3]. Consistent with randomized clinical trials, BNT162b2 showed high efficiency in a wide range of COVID-19-related outcomes in a real-world setting [5]. Nevertheless, many challenges remain, including monitoring for long-term safety and efficacy of the vaccine. This warrants further evaluation and investigations. The safety profile of BNT162b2 is currently only available from short-term clinical studies. Less common adverse effects of BNT162b2 have been reported, including pericarditis, arrhythmia, deep-vein thrombosis, pulmonary embolism, myocardial infarction, intracranial hemorrhage, and thrombocytopenia [4,9,10,11,12,13,14,15,16,17,18,19,20]. There are also studies that report adverse effects observed in other types of vaccines [21,22,23,24]. To better understand mechanisms underlying vaccine-related adverse effects, clinical investigations as well as cellular and molecular analyses are needed.

A recent study showed that SARS-CoV-2 RNAs can be reverse-transcribed and integrated into the genome of human cells [25]. This gives rise to the question of if this may also occur with BNT162b2, which encodes partial SARS-CoV-2 RNA. In pharmacokinetics data provided by Pfizer to European Medicines Agency (EMA), BNT162b2 biodistribution was studied in mice and rats by intra-muscular injection with radiolabeled LNP and luciferase modRNA. Radioactivity was detected in most tissues from the first time point (0.25 h), and results showed that the injection site and the liver were the major sites of distribution, with maximum concentrations observed at 8–48 h post-dose [26]. Furthermore, in animals that received the BNT162b2 injection, reversible hepatic effects were observed, including enlarged liver, vacuolation, increased gamma glutamyl transferase (γGT) levels, and increased levels of aspartate transaminase (AST) and alkaline phosphatase (ALP) [26]. Transient hepatic effects induced by LNP delivery systems have been reported previously [27,28,29,30], nevertheless, it has also been shown that the empty LNP without modRNA alone does not introduce any significant liver injury [27]. Therefore, in this study, we aim to examine the effect of BNT162b2 on a human liver cell line in vitro and investigate if BNT162b2 can be reverse transcribed into DNA through endogenous mechanisms.

2. Materials and Methods

2.1. Cell Culture

Huh7 cells (JCRB Cell Bank, Osaka, Japan) were cultured in 37 °C at 5% CO₂ with DMEM medium (HyClone, HYCLSH30243.01) supplemented with 10% (v/v) fetal bovine serum (Sigma-Aldrich, F7524-500ML, Burlington, MA, USA) and 1% (v/v) Penicillin-Streptomycin (HyClone, SV30010, Logan, UT, USA). For BNT162b2 treatment, Huh7 cells were seeded with a density of 200,000 cells/well in 24-well plates. BNT162b2 mRNA vaccine (Pfizer BioNTech, New York, NY, USA) was diluted with sterile 0.9% sodium chloride injection, USP into a final concentration of 100 μg/mL as described in the manufacturer’s guideline [31]. BNT162b2 suspension was then added in cell culture media to reach final concentrations of 0.5, 1.0, or 2.0 μg/mL. Huh7 cells were incubated with or without BNT162b2 for 6, 24, and 48 h. Cells were washed thoroughly with PBS and harvested by trypsinization and stored in −80 °C until further use.

2.2. REAL-TIME RT-QPCR

RNA from the cells was extracted with RNeasy Plus Mini Kit (Qiagen, 74134, Hilden, Germany) following the manufacturer’s protocol. RT-PCR was performed using RevertAid First Strand cDNA Synthesis kit (Thermo Fisher Scientific, K1622, Waltham, MA, USA) following the manufacturers protocol. Real-time qPCR was performed using Maxima SYBR Green/ROX qPCR Master Mix (Thermo Fisher Scientific, K0222, Waltham, MA, USA) with primers for BNT162b2, LINE-1 and housekeeping genes ACTB and GAPDH (Table 1).

Table 1. Primer sequences of RT-qPCR and PCR.

Target	Sequence
ACTB forward	CCTCGCCTTTGCCGATCC
ACTB reverse	GGATCTTCATGAGGTAGTCAGTC
GAPDH forward	CTCTGCTCCTCCTGTTCGAC
GAPDH reverse	TTAAAAGCAGCCCTGGTGAC
LINE-1 forward	TAACCAATACAGAGAAGTGC
LINE-1 reverse	GATAATATCCTGCAGAGTGT
BNT162b2 forward	CGAGGTGGCCAAGAATCTGA
BNT162b2 reverse	TAGGCTAAGCGTTTTGAGCTG

2.3. Immunofluorescence Staining and Confocal Imaging

Huh7 cells were cultured in eight-chamber slides (LAB-TEK, 154534, Santa Cruz, CA, USA) with a density of 40,000 cells/well, with or without BNT162b2 (0.5, 1 or 2 µg/mL) for 6 h. Immunohistochemistry was performed using primary antibody anti-LINE-1 ORF1p mouse monoclonal antibody (Merck, 3574308, Kenilworth, NJ, USA), secondary antibody Cy3 Donkey anti-mouse (Jackson ImmunoResearch, West Grove, PA, USA), and Hoechst (Life technologies, 34850, Carlsbad, CA, USA), following the protocol from Thermo Fisher (Waltham, MA, USA). Two images per condition were taken using a Zeiss LSM 800 and a 63X oil immersion objective, and the staining intensity was quantified on the individual whole cell area and the nucleus area on 15 cells per image by ImageJ 1.53c. LINE-1 staining intensity for the cytosol was calculated by subtracting the intensity of the nucleus from that of the whole cell. All images of the cells were assigned a random number to prevent bias. To mark the nuclei (determined by the Hoechst staining) and the whole cells (determined by the borders of the LINE-1 fluorescence), the Freehand selection tool was used. These areas were then measured, and the mean intensity was used to compare the groups.

2.4. Genomic DNA Purification, PCR Amplification, Agarose Gel Purification, and Sanger Sequencing

Genomic DNA was extracted from cell pellets with PBND buffer (10 mM Tris-HCl pH 8.3, 50 mM KCl, 2.5 mM MgCl2, 0.45% NP-40, 0.45% Tween-20) according to protocol described previously [32]. To remove residual RNA from the DNA preparation, RNase (100 µg/mL, Qiagen, Hilden, Germany) was added to the DNA preparation and incubated at 37 °C for 3 h, followed by 5 min at 95 °C. PCR was then performed using primers targeting BNT162b2 (sequences are shown in Table 1), with the following program: 5 min at 95 °C, 35 cycles of 95 °C for 30 s, 58 °C for 30 s, and 72 °C for 1 min; finally, 72 °C for 5 min and 12 °C for 5 min. PCR products were run on 1.4% (w/v) agarose gel. Bands corresponding to the amplicons of the expected size (444 bps) were cut out and DNA was extracted using QIAquick PCR Purification Kit (Qiagen, 28104, Hilden, Germany), following the manufacturer’s instructions. The sequence of the DNA amplicon was verified by Sanger sequencing (Eurofins Genomics, Ebersberg, Germany).

Statistics

Statistical comparisons were performed using two-tailed Student’s t-test and ANOVA. Data are expressed as the mean ± SEM or ± SD. Differences with p < 0.05 are considered significant.

2.5. Ethical Statements

The Huh7 cell line was obtained from Japanese Collection of Research Bioresources (JCRB) Cell Bank.

3. Results

3.1. BNT162b2 Enters Human Liver Cell Line Huh7 Cells at High Efficiency

To determine if BNT162b2 enters human liver cells, we exposed human liver cell line Huh7 to BNT162b2. In a previous study on the uptake kinetics of LNP delivery in Huh7 cells, the maximum biological efficacy of LNP was observed between 4–7 h [33]. Therefore, in our study, Huh7 cells were cultured with or without increasing concentrations of BNT162b2 (0.5, 1.0 and 2.0 µg/mL) for 6, 24, and 48 h. RNA was extracted from cells and a real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR) was performed using primers targeting the BNT162b2 sequence, as illustrated in Figure 1. The full sequence of BNT162b2 is publicly available [34] and contains a two-nucleotides cap; 5′- untranslated region (UTR) that incorporates the 5′ -UTR of a human α-globin gene; the full-length of SARS-CoV-2 S protein with two proline mutations; 3′-UTR that incorporates the human mitochondrial 12S rRNA (mtRNR1) segment and human AES/TLE5 gene segment with two C→U mutations; poly(A) tail. Detailed analysis of the S protein sequence in BNT162b2 revealed 124 sequences that are 100% identical to human genomic sequences and three sequences with only one nucleotide (nt) mismatch in 19–26 nts (Table S1, see Supplementary Materials). To detect BNT162b2 RNA level, we designed primers with forward primer located in SARS-CoV-2 S protein regions and reverse primer in 3′-UTR, which allows detection of PCR amplicon unique to BNT162b2 without unspecific binding of the primers to human genomic regions.

Figure 1. PCR primer set used to detect mRNA level and reverse-transcription of BNT162b2. Illustration of BNT162b2 was adapted from previously described literature [34].

RT-qPCR results showed that Huh7 cells treated with BNT162b2 had high levels of BNT162b2 mRNA relative to housekeeping genes at 6, 24, and 48 h (Figure 2, presented in logged 2^−ΔΔCT due to exceptionally high levels). The three BNT162b2 concentrations led to similar intracellular BNT162b2 mRNA levels at the different time points, except that the significant difference between 1.0 and 2.0 µg/mL was observed at 48 h. BNT162b2 mRNA levels were significantly decreased at 24 h compared to 6 h, but increased again at 48 h.

Figure 2. BNT162b2 mRNA levels in Huh7 cells treated with BNT162b2. Huh7 cells were treated without (Ctrl) or with 0.5 (V1), 1 (V2), and 2 µg/mL (V3) of BNT162b2 for 6 (green dots), 24 (orange dots), and 48 h (blue dots). RNA was purified and qPCR was performed using primers targeting BNT162b2. RNA levels of BNT162b2 are presented as logged 2^−ΔΔCT values relative to house-keeping genes GAPDH and ACTB. Results are from five independent experiments (n = 5). Differences between respective groups were analyzed using two-tailed Student’s t-test. Data are expressed as the mean ± SEM. (* p < 0.05; ** p < 0.01; *** p < 0.001 vs. respective control at each time point, or as indicated).

3.2. Effect of BNT162b2 on Human Endogenous Reverse Transcriptase Long Interspersed Nuclear Element-1 (LINE-1)

Here we examined the effect of BNT162b2 on LINE-1 gene expression. RT-qPCR was performed on RNA purified from Huh7 cells treated with BNT162b2 (0, 0.5, 1.0, and 2.0 µg/mL) for 6, 24, and 48 h, using primers targeting LINE-1. Significantly increased LINE-1 expression compared to control was observed at 6 h by 2.0 µg/mL BNT162b2, while lower BNT162b2 concentrations decreased LINE-1 expression at all time points (Figure 3).

Figure 3. LINE-1 mRNA levels in Huh7 cells treated with BNT162b2. Huh7 cells were treated without (Ctrl) or with 0.5 (V1), 1 (V2), and 2 µg/mL (V3) of BNT162b2 for 6 (green dots), 24 (red dots), and 48 h (blue dots). RNA was purified and qPCR was performed using primers targeting LINE-1. RNA levels of LINE-1 are presented as 2^−ΔΔCT values relative to house-keeping genes GAPDH and ACTB. Results are from five independent experiments (n = 5). Differences between respective groups were analyzed using two-tailed Student’s t-test. Data are expressed as the mean ± SEM. (* p < 0.05; ** p < 0.01; *** p < 0.001 vs. respective control at each time point, or as indicated; † p < 0.05 vs. 6 h-Ctrl).

Next, we studied the effect of BNT162b2 on LINE-1 protein level. The full-length LINE-1 consists of a 5′ untranslated region (UTR), two open reading frames (ORFs), ORF1 and ORF2, and a 3′UTR, of which ORF1 is an RNA binding protein with chaperone activity. The retrotransposition activity of LINE-1 has been demonstrated to involve ORF1 translocation to the nucleus [35]. Huh7 cells treated with or without BNT162b2 (0.5, 1.0 and 2.0 µg/mL) for 6 h were fixed and stained with antibodies binding to LINE-1 ORF1p, and DNA-specific probe Hoechst for visualization of cell nucleus (Figure 4a). Quantification of immunofluorescence staining intensity showed that BNT162b2 increased LINE-1 ORF1p protein levels in both the whole cell area and nucleus at all concentrations tested (Figure 4b–d).

Figure 4. Immunohistochemistry of Huh7 cells treated with BNT162b2 on LINE-1 protein distribution. Huh7 cells were treated without (Ctrl) or with 0.5, 1, and 2 µg/mL of BNT162b2 for 6 h. Cells were fixed and stained with antibodies binding to LINE-1 ORF1p (red) and DNA-specific probe Hoechst for visualization of cell nucleus (blue). (a) Representative images of LINE-1 expression in Huh7 cells treated with or without BNT162b2. (b–d) Quantification of LINE-1 protein in whole cell area (b), cytosol (c), and nucleus (d). All data were analyzed using One-Way ANOVA, and graphs were created using GraphPad Prism V 9.2. All data is presented as mean ± SD (** p < 0.01; *** p < 0.001; **** p < 0.0001 as indicated).

3.3. Detection of Reverse Transcribed BNT162b2 DNA in Huh7 Cells

A previous study has shown that entry of LINE-1 protein into the nucleus is associated with retrotransposition [35]. In the immunofluorescence staining experiment described above, increased levels of LINE-1 in the nucleus were observed already at the lowest concentration of BNT162b2 (0.5 µg/mL). To examine if BNT162b2 is reversely transcribed into DNA when LINE-1 is elevated, we purified genomic DNA from Huh7 cells treated with 0.5 µg/mL of BNT162b2 for 6, 24, and 48 h. Purified DNA was treated with RNase to remove RNA and subjected to PCR using primers targeting BNT162b2, as illustrated in Figure 1. Amplified DNA fragments were then visualized by electrophoresis and gel-purified (Figure 5). BNT162b2 DNA amplicons were detected in all three time points (6, 24, and 48 h). Sanger sequencing confirmed that the DNA amplicons were identical to the BNT162b2 sequence flanked by the primers (Table 2). To ensure that the DNA amplicons were derived from DNA but not BNT162b2 RNA, we also performed PCR on RNA purified from Huh7 cells treated with 0.5 µg/mL BNT162b2 for 6 h, with or without RNase treatment (Ctrl 5 and 6 in Figure 5), and no amplicon was detected in the RNA samples subjected to PCR.

Figure 5. Detection of DNA amplicons of BNT162b2 in Huh7 cells treated with BNT162b2. Huh7 cells were treated without (Ctrl) or with 0.5 µg/mL of BNT162b2 for 6, 24, and 48 h. Genomic DNA was purified and digested with 100 µg/mL RNase. PCR was run on all samples with primers targeting BNT162b2, as shown in Figure 1 and Table 1. DNA amplicons (444 bps) were visualized on agarose gel. BNT: BNT162b2; L: DNA ladder; Ctrl1: cultured Huh7 cells; Ctrl2: Huh7 cells without BNT162b2 treatment collected at 6 h; Ctrl3: Huh7 cells without BNT162b2 treatment collected at 24 h; Ctrl4: Huh7 cells without BNT162b2 treatment collected at 48 h; Ctrl5: RNA from Huh7 cells treated with 0.5 µg/mL of BNT162b2 for 6 h; Ctrl6: RNA from Huh7 cells treated with 0.5 µg/mL of BNT162b2 for 6 h, digested with RNase.

Table 2. Sanger sequencing result of the BNT162b2 amplicon.

CGAGGTGGCCAAGAATCTGAACGAGAGCCTGATCGACCTGCAAGAACTGGGGAAGT ACGAGCAGTACATCAAGTGGCCCTGGTACATCTGGCTGGGCTTTATCGCCGGACTGATTG CCATCGTGATGGTCACAATCATGCTGTGTTGCATGACCAGCTGCTGTAGCTGCCTGAAGG GCTGTTGTAGCTGTGGCAGCTGCTGCAAGTTCGACGAGGACGATTCTGAGCCCGTGCTGA

AGGGCGTGAAACTGCACTACACATGATGACTCGAGCTGGTACTGCATGCACGCAATGCTA GCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGC TCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCCAAGCACGC AGCAATGCAGCTCAAAACGCTTAGCCTA

4. Discussion

In this study we present evidence that COVID-19 mRNA vaccine BNT162b2 is able to enter the human liver cell line Huh7 in vitro. BNT162b2 mRNA is reverse transcribed intracellularly into DNA as fast as 6 h after BNT162b2 exposure. A possible mechanism for reverse transcription is through endogenous reverse transcriptase LINE-1, and the nucleus protein distribution of LINE-1 is elevated by BNT162b2.

Intracellular accumulation of LNP in hepatocytes has been demonstrated in vivo [36]. A preclinical study on BNT162b2 showed that BNT162b2 enters the human cell line HEK293T cells and leads to robust expression of BNT162b2 antigen [37]. Therefore, in this study, we first investigated the entry of BNT162b2 in the human liver cell line Huh7 cells. The choice of BNT162b2 concentrations used in this study warrants explanation. BNT162b2 is administered as a series of two doses three weeks apart, and each dose contains 30 µg of BNT162b2 in a volume of 0.3 mL, which makes the local concentration at the injection site at the highest 100 µg/mL [31]. A previous study on mRNA vaccines against H10N8 and H7N9 influenza viruses using a similar LNP delivery system showed that the mRNA vaccine can distribute rather nonspecifically to several organs such as liver, spleen, heart, kidney, lung, and brain, and the concentration in the liver is roughly 100 times lower than that of the intra-muscular injection site [38]. In the assessment report on BNT162b2 provided to EMA by Pfizer, the pharmacokinetic distribution studies in rats demonstrated that a relatively large proportion (up to 18%) of the total dose distributes to the liver [26]. We therefore chose to use 0.5, 1, and 2 μg/mL of vaccine in our experiments on the liver cells. However, the effect of a broader range of lower and higher concentrations of BNT162b2 should also be verified in future studies.

In the current study, we employed a human liver cell line for in vitro investigation. It is worth investigating if the liver cells also present the vaccine-derived SARS-CoV-2 spike protein, which could potentially make the liver cells targets for previously primed spike protein reactive cytotoxic T cells. There has been case reports on individuals who developed autoimmune hepatitis [39] after BNT162b2 vaccination. To obtain better understanding of the potential effects of BNT162b2 on liver function, in vivo models are desired for future studies.

In the BNT162b2 toxicity report, no genotoxicity nor carcinogenicity studies have been provided [26]. Our study shows that BNT162b2 can be reverse transcribed to DNA in liver cell line Huh7, and this may give rise to the concern if BNT162b2-derived DNA may be integrated into the host genome and affect the integrity of genomic DNA, which may potentially mediate genotoxic side effects. At this stage, we do not know if DNA reverse transcribed from BNT162b2 is integrated into the cell genome. Further studies are needed to demonstrate the effect of BNT162b2 on genomic integrity, including whole genome sequencing of cells exposed to BNT162b2, as well as tissues from human subjects who received BNT162b2 vaccination.

Human autonomous retrotransposon LINE-1 is a cellular endogenous reverse transcriptase and the only remaining active transposon in humans, able to retrotranspose itself and other nonautonomous elements [40,41], and ~17% of the human genome are comprised of LINE-1 sequences [42]. The nonautonomous Alu elements, short, interspersed nucleotide elements (SINEs), variable-number-of-tandem-repeats (VNTR), as well as cellular mRNA-processed pseudogenes, are retrotransposed by the LINE-1 retrotransposition proteins working in trans [43,44]. A recent study showed that endogenous LINE-1 mediates reverse transcription and integration of SARS-CoV-2 sequences in the genomes of infected human cells [25]. Furthermore, expression of endogenous LINE-1 is often increased upon viral infection, including SARS-CoV-2 infection [45,46,47]. Previous studies showed that LINE-1 retrotransposition activity is regulated by RNA metabolism [48,49], DNA damage response [50], and autophagy [51]. Efficient retrotransposition of LINE-1 is often associated with cell cycle and nuclear envelope breakdown during mitosis [52,53], as well as exogenous retroviruses [54,55], which promotes entrance of LINE-1 into the nucleus. In our study, we observed increased LINE-1 ORF1p distribution as determined by immunohistochemistry in the nucleus by BNT162b2 at all concentrations tested (0.5, 1, and 2 μg/mL), while elevated LINE-1 gene expression was detected at the highest BNT162b2 concentration (2 μg/mL). It is worth noting that gene transcription is regulated by chromatin modifications, transcription factor regulation, and the rate of RNA degradation, while translational regulation of protein involves ribosome recruitment on the initiation codon, modulation of peptide elongation, termination of protein synthesis, or ribosome biogenesis. These two processes are controlled by different mechanisms, and therefore they may not always show the same change patterns in response to external challenges. The exact regulation of LINE-1 activity in response to BNT162b2 merits further study.

The cell model that we used in this study is a carcinoma cell line, with active DNA replication which differs from non-dividing somatic cells. It has also been shown that Huh7 cells display significant different gene and protein expression including upregulated proteins involved in RNA metabolism [56]. However, cell proliferation is also active in several human tissues such as the bone marrow or basal layers of epithelia as well as during embryogenesis, and it is therefore necessary to examine the effect of BNT162b2 on genomic integrity under such conditions. Furthermore, effective retrotransposition of LINE-1 has also been reported in non-dividing and terminally differentiated cells, such as human neurons [57,58].

The Pfizer EMA assessment report also showed that BNT162b2 distributes in the spleen (<1.1%), adrenal glands (<0.1%), as well as low and measurable radioactivity in the ovaries and testes (<0.1%) [26]. Furthermore, no data on placental transfer of BNT162b2 is available from Pfizer EMA assessment report. Our results showed that BNT162b2 mRNA readily enters Huh7 cells at a concentration (0.5 µg/mL) corresponding to 0.5% of the local injection site concentration, induce changes in LINE-1 gene and protein expression, and within 6 h, reverse transcription of BNT162b2 can be detected. It is therefore important to investigate further the effect of BNT162b2 on other cell types and tissues both in vitro and in vivo.

5. Conclusions

Our study is the first in vitro study on the effect of COVID-19 mRNA vaccine BNT162b2 on human liver cell line. We present evidence on fast entry of BNT162b2 into the cells and subsequent intracellular reverse transcription of BNT162b2 mRNA into DNA.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/cimb44030073/s1.

Author Contributions

M.A., F.O.F., D.Y., M.B. and C.L. performed in vitro experiments. M.A. and F.O.F. performed data analysis. M.R. and Y.D.M. contributed to the implementation of the research, designed, and supervised the study. Y.D.M. wrote the paper with input from all authors. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by the Swedish Research Council (SRC), Strategic Research Area Exodiab, Dnr 2009-1039, the Swedish Government Fund for Clinical Research (ALF) and the foundation of Skåne University Hospital.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data supporting the findings of this study are available within the article and supporting information.

Acknowledgments

The authors thank Sven Haidl, Maria Josephson, Enming Zhang, Jia-Yi Li, Caroline Haikal, and Pradeep Bompada for their support to this study.

Conflicts of Interest

The authors declare no conflict of interest.

References

World Health Organization. Coronavirus (COVID-19) Dashboard. Available online: https://covid19.who.int/ (accessed on 22 February 2022).
Mulligan, M.J.; Lyke, K.E.; Kitchin, N.; Absalon, J.; Gurtman, A.; Lockhart, S.; Neuzil, K.; Raabe, V.; Bailey, R.; Swanson, K.A.; et al. Phase I/II study of COVID-19 RNA vaccine BNT162b1 in adults. Nature 2020, 586, 589–593. [Google Scholar] [CrossRef] [PubMed]
Walsh, E.E.; Frenck, R.W., Jr.; Falsey, A.R.; Kitchin, N.; Absalon, J.; Gurtman, A.; Lockhart, S.; Neuzil, K.; Mulligan, M.J.; Bailey, R.; et al. Safety and Immunogenicity of Two RNA-Based COVID-19 Vaccine Candidates. N. Engl. J. Med. 2020, 383, 2439–2450. [Google Scholar] [CrossRef] [PubMed]
Polack, F.P.; Thomas, S.J.; Kitchin, N.; Absalon, J.; Gurtman, A.; Lockhart, S.; Perez, J.L.; Perez Marc, G.; Moreira, E.D.; Zerbini, C.; et al. Safety and Efficacy of the BNT162b2 mRNA COVID-19 Vaccine. N. Engl. J. Med. 2020, 383, 2603–2615. [Google Scholar] [CrossRef] [PubMed]
Harris, R.J.; Hall, J.A.; Zaidi, A.; Andrews, N.J.; Dunbar, J.K.; Dabrera, G. Effect of Vaccination on Household Transmission of SARS-CoV-2 in England. N. Engl. J. Med. 2021, 385, 759–760. [Google Scholar] [CrossRef]
Butt, A.A.; Omer, S.B.; Yan, P.; Shaikh, O.S.; Mayr, F.B. SARS-CoV-2 Vaccine Effectiveness in a High-Risk National Population in a Real-World Setting. Ann. Intern. Med. 2021, 174, 1404–1408. [Google Scholar] [CrossRef]
Dagan, N.; Barda, N.; Kepten, E.; Miron, O.; Perchik, S.; Katz, M.A.; Hernan, M.A.; Lipsitch, M.; Reis, B.; Balicer, R.D. BNT162b2 mRNA Covid-19 Vaccine in a Nationwide Mass Vaccination Setting. N. Engl. J. Med. 2021, 384, 1412–1423. [Google Scholar] [CrossRef]
Rossman, H.; Shilo, S.; Meir, T.; Gorfine, M.; Shalit, U.; Segal, E. COVID-19 dynamics after a national immunization program in Israel. Nat. Med. 2021, 27, 1055–1061. [Google Scholar] [CrossRef]
Fan, B.E.; Shen, J.Y.; Lim, X.R.; Tu, T.M.; Chang, C.C.R.; Khin, H.S.W.; Koh, J.S.; Rao, J.P.; Lau, S.L.; Tan, G.B.; et al. Cerebral venous thrombosis post BNT162b2 mRNA SARS-CoV-2 vaccination: A black swan event. Am. J. Hematol. 2021, 96, E357–E361. [Google Scholar] [CrossRef]
Larson, K.F.; Ammirati, E.; Adler, E.D.; Cooper, L.T., Jr.; Hong, K.N.; Saponara, G.; Couri, D.; Cereda, A.; Procopio, A.; Cavalotti, C.; et al. Myocarditis After BNT162b2 and mRNA-1273 Vaccination. Circulation 2021, 144, 506–508. [Google Scholar] [CrossRef]
Menni, C.; Klaser, K.; May, A.; Polidori, L.; Capdevila, J.; Louca, P.; Sudre, C.H.; Nguyen, L.H.; Drew, D.A.; Merino, J.; et al. Vaccine side-effects and SARS-CoV-2 infection after vaccination in users of the COVID Symptom Study app in the UK: A prospective observational study. Lancet Infect. Dis. 2021, 21, 939–949. [Google Scholar] [CrossRef]
Hansen, T.; Titze, U.; Kulamadayil-Heidenreich, N.S.A.; Glombitza, S.; Tebbe, J.J.; Rocken, C.; Schulz, B.; Weise, M.; Wilkens, L. First case of postmortem study in a patient vaccinated against SARS-CoV-2. Int. J. Infect. Dis. 2021, 107, 172–175. [Google Scholar] [CrossRef] [PubMed]
Kadali, R.A.K.; Janagama, R.; Peruru, S.; Malayala, S.V. Side effects of BNT162b2 mRNA COVID-19 vaccine: A randomized, cross-sectional study with detailed self-reported symptoms from healthcare workers. Int. J. Infect. Dis. 2021, 106, 376–381. [Google Scholar] [CrossRef] [PubMed]
Parkash, O.; Sharko, A.; Farooqi, A.; Ying, G.W.; Sura, P. Acute Pancreatitis: A Possible Side Effect of COVID-19 Vaccine. Cureus 2021, 13, e14741. [Google Scholar] [CrossRef] [PubMed]
Mazzatenta, C.; Piccolo, V.; Pace, G.; Romano, I.; Argenziano, G.; Bassi, A. Purpuric lesions on the eyelids developed after BNT162b2 mRNA COVID-19 vaccine: Another piece of SARS-CoV-2 skin puzzle? J. Eur. Acad. Dermatol. Venereol. 2021, 35, e543–e545. [Google Scholar] [CrossRef]
Lee, E.J.; Cines, D.B.; Gernsheimer, T.; Kessler, C.; Michel, M.; Tarantino, M.D.; Semple, J.W.; Arnold, D.M.; Godeau, B.; Lambert, M.P.; et al. Thrombocytopenia following Pfizer and Moderna SARS-CoV-2 vaccination. Am. J. Hematol. 2021, 96, 534–537. [Google Scholar] [CrossRef]
Ishay, Y.; Kenig, A.; Tsemach-Toren, T.; Amer, R.; Rubin, L.; Hershkovitz, Y.; Kharouf, F. Autoimmune phenomena following SARS-CoV-2 vaccination. Int. Immunopharmacol. 2021, 99, 107970. [Google Scholar] [CrossRef]
Das, B.B.; Kohli, U.; Ramachandran, P.; Nguyen, H.H.; Greil, G.; Hussain, T.; Tandon, A.; Kane, C.; Avula, S.; Duru, C.; et al. Myopericarditis following mRNA COVID-19 Vaccination in Adolescents 12 through 18 Years of Age. J. Pediatr. 2021, 238, 26–32.e1. [Google Scholar] [CrossRef]
McLaurin-Jiang, S.; Garner, C.D.; Krutsch, K.; Hale, T.W. Maternal and Child Symptoms Following COVID-19 Vaccination Among Breastfeeding Mothers. Breastfeed. Med. 2021, 16, 702–709. [Google Scholar] [CrossRef]
Barda, N.; Dagan, N.; Ben-Shlomo, Y.; Kepten, E.; Waxman, J.; Ohana, R.; Hernan, M.A.; Lipsitch, M.; Kohane, I.; Netzer, D.; et al. Safety of the BNT162b2 mRNA Covid-19 Vaccine in a Nationwide Setting. N. Engl. J. Med. 2021, 385, 1078–1090. [Google Scholar] [CrossRef]
Baden, L.R.; El Sahly, H.M.; Essink, B.; Kotloff, K.; Frey, S.; Novak, R.; Diemert, D.; Spector, S.A.; Rouphael, N.; Creech, C.B.; et al. Efficacy and Safety of the mRNA-1273 SARS-CoV-2 Vaccine. N. Engl. J. Med. 2021, 384, 403–416. [Google Scholar] [CrossRef]
Sadoff, J.; Gray, G.; Vandebosch, A.; Cardenas, V.; Shukarev, G.; Grinsztejn, B.; Goepfert, P.A.; Truyers, C.; Fennema, H.; Spiessens, B.; et al. Safety and Efficacy of Single-Dose Ad26.COV2.S Vaccine against Covid-19. N. Engl. J. Med. 2021, 384, 2187–2201. [Google Scholar] [CrossRef] [PubMed]
Eichinger, S.; Warkentin, T.E.; Greinacher, A. Thrombotic Thrombocytopenia after ChAdOx1 nCoV-19 Vaccination. Reply. N. Engl. J. Med. 2021, 385, e11. [Google Scholar] [CrossRef] [PubMed]
Doroftei, B.; Ciobica, A.; Ilie, O.D.; Maftei, R.; Ilea, C. Mini-Review Discussing the Reliability and Efficiency of COVID-19 Vaccines. Diagnostics 2021, 11, 579. [Google Scholar] [CrossRef]
Zhang, L.; Richards, A.; Barrasa, M.I.; Hughes, S.H.; Young, R.A.; Jaenisch, R. Reverse-transcribed SARS-CoV-2 RNA can integrate into the genome of cultured human cells and can be expressed in patient-derived tissues. Proc. Natl. Acad. Sci. USA 2021, 118, e2105968118. [Google Scholar] [CrossRef] [PubMed]
Available online: https://www.ema.europa.eu/en/documents/assessment-report/comirnaty-epar-public-assessment-report_en.pdf (accessed on 24 February 2022).
Tanaka, H.; Takata, N.; Sakurai, Y.; Yoshida, T.; Inoue, T.; Tamagawa, S.; Nakai, Y.; Tange, K.; Yoshioka, H.; Maeki, M.; et al. Delivery of Oligonucleotides Using a Self-Degradable Lipid-Like Material. Pharmaceutics 2021, 13, 544. [Google Scholar] [CrossRef]
Sedic, M.; Senn, J.J.; Lynn, A.; Laska, M.; Smith, M.; Platz, S.J.; Bolen, J.; Hoge, S.; Bulychev, A.; Jacquinet, E.; et al. Safety Evaluation of Lipid Nanoparticle-Formulated Modified mRNA in the Sprague-Dawley Rat and Cynomolgus Monkey. Vet. Pathol. 2018, 55, 341–354. [Google Scholar] [CrossRef]
Sato, Y.; Matsui, H.; Yamamoto, N.; Sato, R.; Munakata, T.; Kohara, M.; Harashima, H. Highly specific delivery of siRNA to hepatocytes circumvents endothelial cell-mediated lipid nanoparticle-associated toxicity leading to the safe and efficacious decrease in the hepatitis B virus. J. Control. Release 2017, 266, 216–225. [Google Scholar] [CrossRef]
Heidel, J.D.; Yu, Z.; Liu, J.Y.; Rele, S.M.; Liang, Y.; Zeidan, R.K.; Kornbrust, D.J.; Davis, M.E. Administration in non-human primates of escalating intravenous doses of targeted nanoparticles containing ribonucleotide reductase subunit M2 siRNA. Proc. Natl. Acad. Sci. USA 2007, 104, 5715–5721. [Google Scholar] [CrossRef]
Available online: https://www.cvdvaccine-us.com/ (accessed on 24 February 2022).
Available online: http://bridgeslab.sph.umich.edu/protocols/index.php/Preparation_of_Tail_Samples_(for_Genotyping) (accessed on 24 February 2022).
Gallud, A.; Munson, M.J.; Liu, K.; Idstrom, A.; Barriga, H.M.; Tabaei, S.; Aliakbarinodehi, N.; Ojansivu, M.; Lubart, Q.; Doutch, J.J.; et al. Time evolution of PEG-shedding and serum protein coronation determines the cell uptake kinetics and delivery of lipid nanoparticle. bioRxiv 2021. [Google Scholar] [CrossRef]
World Health Organization Messenger RNA Encoding the Full-Length SARS-CoV-2 Spike Glycoprotein. 2020. Available online: https://web.archive.org/web/20210105162941/https://mednet-communities.net/inn/db/media/docs/11889.doc (accessed on 24 February 2022).
Mita, P.; Wudzinska, A.; Sun, X.; Andrade, J.; Nayak, S.; Kahler, D.J.; Badri, S.; LaCava, J.; Ueberheide, B.; Yun, C.Y.; et al. LINE-1 protein localization and functional dynamics during the cell cycle. Elife 2018, 7, e30058. [Google Scholar] [CrossRef]
Sato, Y.; Kinami, Y.; Hashiba, K.; Harashima, H. Different kinetics for the hepatic uptake of lipid nanoparticles between the apolipoprotein E/low density lipoprotein receptor and the N-acetyl-d-galactosamine/asialoglycoprotein receptor pathway. J. Control. Release 2020, 322, 217–226. [Google Scholar] [CrossRef]
Vogel, A.B.; Kanevsky, I.; Che, Y.; Swanson, K.A.; Muik, A.; Vormehr, M.; Kranz, L.M.; Walzer, K.C.; Hein, S.; Guler, A.; et al. BNT162b vaccines protect rhesus macaques from SARS-CoV-2. Nature 2021, 592, 283–289. [Google Scholar] [CrossRef] [PubMed]
Bahl, K.; Senn, J.J.; Yuzhakov, O.; Bulychev, A.; Brito, L.A.; Hassett, K.J.; Laska, M.E.; Smith, M.; Almarsson, O.; Thompson, J.; et al. Preclinical and Clinical Demonstration of Immunogenicity by mRNA Vaccines against H10N8 and H7N9 Influenza Viruses. Mol. Ther. 2017, 25, 1316–1327. [Google Scholar] [CrossRef] [PubMed]
Bril, F.; Al Diffalha, S.; Dean, M.; Fettig, D.M. Autoimmune hepatitis developing after coronavirus disease 2019 (COVID-19) vaccine: Causality or casualty? J. Hepatol. 2021, 75, 222–224. [Google Scholar] [CrossRef]
Kazazian, H.H., Jr.; Moran, J.V. Mobile DNA in Health and Disease. N. Engl. J. Med. 2017, 377, 361–370. [Google Scholar] [CrossRef] [PubMed]
Coffin, J.M.; Fan, H. The Discovery of Reverse Transcriptase. Annu. Rev. Virol. 2016, 3, 29–51. [Google Scholar] [CrossRef]
Lander, E.S.; Linton, L.M.; Birren, B.; Nusbaum, C.; Zody, M.C.; Baldwin, J.; Devon, K.; Dewar, K.; Doyle, M.; FitzHugh, W.; et al. Initial sequencing and analysis of the human genome. Nature 2001, 409, 860–921. [Google Scholar] [CrossRef]
Ostertag, E.M.; Goodier, J.L.; Zhang, Y.; Kazazian, H.H., Jr. SVA elements are nonautonomous retrotransposons that cause disease in humans. Am. J. Hum. Genet. 2003, 73, 1444–1451. [Google Scholar] [CrossRef]
Hancks, D.C.; Kazazian, H.H., Jr. Active human retrotransposons: Variation and disease. Curr. Opin. Genet. Dev. 2012, 22, 191–203. [Google Scholar] [CrossRef]
Jones, R.B.; Song, H.; Xu, Y.; Garrison, K.E.; Buzdin, A.A.; Anwar, N.; Hunter, D.V.; Mujib, S.; Mihajlovic, V.; Martin, E.; et al. LINE-1 retrotransposable element DNA accumulates in HIV-1-infected cells. J. Virol. 2013, 87, 13307–13320. [Google Scholar] [CrossRef]
Macchietto, M.G.; Langlois, R.A.; Shen, S.S. Virus-induced transposable element expression up-regulation in human and mouse host cells. Life Sci. Alliance 2020, 3, e201900536. [Google Scholar] [CrossRef] [PubMed]
Yin, Y.; Liu, X.Z.; He, X.; Zhou, L.Q. Exogenous Coronavirus Interacts With Endogenous Retrotransposon in Human Cells. Front. Cell Infect. Microbiol. 2021, 11, 609160. [Google Scholar] [CrossRef] [PubMed]
Belancio, V.P.; Roy-Engel, A.M.; Deininger, P. The impact of multiple splice sites in human L1 elements. Gene 2008, 411, 38–45. [Google Scholar] [CrossRef] [PubMed]
Dai, L.; Taylor, M.S.; O’Donnell, K.A.; Boeke, J.D. Poly(A) binding protein C1 is essential for efficient L1 retrotransposition and affects L1 RNP formation. Mol. Cell Biol. 2012, 32, 4323–4336. [Google Scholar] [CrossRef]
Servant, G.; Streva, V.A.; Derbes, R.S.; Wijetunge, M.I.; Neeland, M.; White, T.B.; Belancio, V.P.; Roy-Engel, A.M.; Deininger, P.L. The Nucleotide Excision Repair Pathway Limits L1 Retrotransposition. Genetics 2017, 205, 139–153. [Google Scholar] [CrossRef]
Guo, H.; Chitiprolu, M.; Gagnon, D.; Meng, L.; Perez-Iratxeta, C.; Lagace, D.; Gibbings, D. Autophagy supports genomic stability by degrading retrotransposon RNA. Nat. Commun. 2014, 5, 5276. [Google Scholar] [CrossRef]
Xie, Y.; Mates, L.; Ivics, Z.; Izsvak, Z.; Martin, S.L.; An, W. Cell division promotes efficient retrotransposition in a stable L1 reporter cell line. Mob. DNA 2013, 4, 10. [Google Scholar] [CrossRef]
Shi, X.; Seluanov, A.; Gorbunova, V. Cell divisions are required for L1 retrotransposition. Mol. Cell Biol. 2007, 27, 1264–1270. [Google Scholar] [CrossRef]
Goff, S.P. Host factors exploited by retroviruses. Nat. Rev. Microbiol 2007, 5, 253–263. [Google Scholar] [CrossRef]
Suzuki, Y.; Craigie, R. The road to chromatin—Nuclear entry of retroviruses. Nat. Rev. Microbiol. 2007, 5, 187–196. [Google Scholar] [CrossRef]
Shi, J.; Wang, X.; Lyu, L.; Jiang, H.; Zhu, H.J. Comparison of protein expression between human livers and the hepatic cell lines HepG2, Hep3B, and Huh7 using SWATH and MRM-HR proteomics: Focusing on drug-metabolizing enzymes. Drug Metab. Pharmacokinet. 2018, 33, 133–140. [Google Scholar] [CrossRef] [PubMed]
Kubo, S.; Seleme, M.C.; Soifer, H.S.; Perez, J.L.; Moran, J.V.; Kazazian, H.H., Jr.; Kasahara, N. L1 retrotransposition in nondividing and primary human somatic cells. Proc. Natl. Acad. Sci. USA 2006, 103, 8036–8041. [Google Scholar] [CrossRef] [PubMed]
Macia, A.; Widmann, T.J.; Heras, S.R.; Ayllon, V.; Sanchez, L.; Benkaddour-Boumzaouad, M.; Munoz-Lopez, M.; Rubio, A.; Amador-Cubero, S.; Blanco-Jimenez, E.; et al. Engineered LINE-1 retrotransposition in nondividing human neurons. Genome Res. 2017, 27, 335–348. [Google Scholar] [CrossRef] [PubMed]

Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).

==========================================

Meer over het farmaceutische maffia lid Pfizer: 'Pfizer CEO: Israëliërs zijn proefkonijn voor testen van vaccin' (!!!!) De CEO van Pfizer die zonder blikken of blozen aangeeft waar het om gaat als men gevaccineerd is....... Israël waar intussen velen al spijt hebben zich te hebben laten vaccineren..... Intussen heeft Pfizer afgezien van een contract met India, daar het land extra garanties wilde over de veiligheid en daar zag Pfizer geen brood in...... India een land met een bevolking van 1,3 miljard mensen, ofwel daar was genoeg winst te behalen voor Pfizer; moet je nagaan..... Er is nog een groot land dat extra veiligheid eiste, waarop Pfizer ook de stekker uit die onderhandelingen trok..... Als je hier naar zoekt op het net, maakt niet uit op wat voor manier, vind je hier niets over terug, tekenend........

'Pfizer CEO calls people who spread vaccine misinformation 'criminals'' Een lid van de farmaceutische maffia die anderen aanwijst als misdadigers..... ha! ha! ha!

'COVID-19: FDA vraagt om volledig rapport over toelating van het Pfizer vaccin tot 2076 geheim te houden >> klokkenluider ontslagen' (!!!!) Ook die zaak wekt 'veel vertrouwen' bij de bevolking, vertrouwen in het vaccin, de Biden administratie en overheidsinstanties als de FDA....... Zoveel vertrouwen als het volgende:

'COVID-19-vaccins: Pfizer maakt misbruik van wanhopige regeringen'

'COVID-19: Pfizer adviseert derde vaccinatie, omzet van dit bedrijf op deze vaccins in 2021 al meer dan 20 miljard dollar.......' (een bericht van 9 juli jl. 2021.....)

'Pfizer Coronavirus vaccin: wat je niet wordt verteld over de vaccins tegen COVID-19' In augustus 2020 deed Pfizer CEO Bourla 62% van z'n aandelen Pfizer van de hand, blijkbaar heeft hij er geen vertrouwen in dat de beloften van overheden dat het bedrijf niet vervolgd zal worden voor ernstige bijwerkingen ook zullen worden geëerbiedigd door rechters mocht men het bedrijf aanklagen voor doden als gevolg van vaccinatie dan wel voor ernstige (chronische) bijwerkingen......

------------------------------------------

Zie voorts: 'Aantal COVID-doden in VS en GB zwaar gemanipuleerd'

'VVD trapt werklozen en bijstandsgerechtigden keihard in het kruis'

'COVID-maatregelen: een open brief aan Ernst Kuipers'

'Oekraïne en 'het truckers protest' tegen COVID-maatregelen in Canada van fundamentalistisch religieus rechts, racisten en ander tuig? Eén grote leugen!!'

'Aartsbisschop Carlo Maria Figanò: “Twee jaar lang zijn we nu getuige van een globale staatsgreep”' (door de Coronamaatregelen) Overigens onbegrijpelijk dat deze aartsbisschop zich in de bijgevoegde video alleen tot katholieken richt......

'COVID-19: onderzoeken bevestigen dat natuurlijke verkregen immuniteit meer dan voldoende is' (!!!!) Op 15 februari 2022, werd bekendgemaakt dat natuurlijke immuniteit veel langer standhoudt dan die middels een vaccin verkregen en dat niet misselijk: volgens onderzoekers in Italië zelfs 18 maanden!! >> 'Natural Immunity Lasts for at Least 18 Months: Study' En wat heeft Nederland gedaan?Juist, die periode van natuurlijke immuniteit teruggebracht naar een half jaar!! Gelukkig zijn we voorlopig af van die belachelijke beslissing!!

'Onverdeeld Open: teken het manifest om het Coronatoegangsbewijs onmiddellijk af te schaffen'

'Hans Teeuwen: "Geen Coronapas"'

'Intrekken uitzendlicentie door Rusland voor Deutsche Welle 'is een klap in het gezicht van het Duitse volk'' RT Deutsch dat werd platgelegd in Duitsland wordt o.a. verweten complottheorieën over COVID te brengen, dit door het uitzenden van een gesprek met een paar COVID-vaccinatieweigeraars....... (te zot voor woorden!!) Oh, en Deutsche Welle is een Duitse staatsomroep die westerse propaganda uitzond in Rusland, iets waarover men niet lult in het westen en als men er al over spreeekt wordt er onomwonden gezegd dat dit soort westerse platforms onafhankelijk zijn..... ha! ha! ha! ha! ha! ha! ha!

'Neil Young en Joni Mitchell maken grote vergissing: censuur niet de weg, terwijl tegengestelde COVID mening meer en meer lijkt te kloppen'

'EU medicijnregelgever EMA en de WHO roepen op te stoppen met COVID boosters vanwege aantasting immuunsysteem en falen bij bestrijding Coronavirus' (!!!!) zie wat dit betreft ook:

'COVID-19 vaccin zou het immuunsysteem aantasten.......' (!!!!) Benieuwd ook of de vandaag (het is terwijl ik dit schrijf 11 januari 2022 /////) overleden David Sassoli, voorzitter van het EU parlement, 3 dubbel gevaccineerd was, daar ook hij een afwijking had aan het immuunsysteem......

'COVID-19: IC verpleegkundige OLVG slaakt noodkreet'

'1.000 driedubbel gevaccineerde Nederlanders lopen het virus op tijdens wintersportvakantie in Oostenrijk'

'CDC (VS) haalt uitspraak van rechter hooggerechtshof onderuit: niet 100.000 ernstig zieke kinderen met COVID in hospitaal maar 3.500....' (!!!!)

'COVID-19: negentig procent van de mensen met omikron is volledig gevaccineerd, ofwel er is sprake van een gevaccineerden pandemie' (!!!!)

'COVID-19: Duitsland gebruikt schapen en geiten om mensen over te halen zich te laten vaccineren ha! ha! ha! ha!'

'COVID-19: Geert Mak (broodschrijver) vindt Nederlander anarchistisch en pleit voor verplichte vaccinatie' (!!!!)

'COVID-19: het bewijs voor Fauci's oorlog tegen de wetenschap' Zie wat dat betreft ook: 'Great Barrington Declaration tegen overmatige en zelfs gevaarlijke Coronamaatregelen'

'COVID-19 'booster': Israël gaat over op een tweede 'boostervaccinatie' vanwege de omikronvariant, terwijl men in het westen stelt dat de eerste booster voldoende beschermt tegen die variant' En dit nadat de ex-minister van Volksgezondheid, CDA blunderkont Hugo de Jonge vorig jaar liet weten dat de eerste 2 vaccinaties voldoende bescherming zouden bieden tegen nieuwe varianten, om daarna op te merken dat mensen die gevaccineerd zijn niet moeten denken dat ze veilig zijn..... ha! ha! ha! ha! (zie de afbeelding met tekst hierboven, in het blok met links naar Pfizer berichten )

'Rapport OVV over Coronacrisis, terwijl straks alles wordt vrijgegeven, maar 'gelukkig' heeft de regering de gegevens van de vaccinweigeraars'

Hier nog wat meer links naar 'oudere berichten': 'COVID-19: Gezondheidsraad houdt zich niet aan de regels van de Raad van Europa: discriminatie van niet-gevaccineerden is verboden' (!!!!)

'Besmette gevaccineerden houden 'gewoon' toegang tot openbare gelegenheden'

'Coronavirus: Diederik Gommers (IC arts) zou het mooi vinden dat mensen worden ingeënt met het AZ vaccin nadat ze tekenden voor het risico dat ze lopen.....' Dan te bedenken dat zelfs de farmaceuten hun eigen vaccin niet vertrouwen, zie wat dat betreft:

'Coronavaccinatie ook als je weet dat de fabrikant ernstige bijwerkingen niet uitsluit?' En zie:

'Coronavaccinatie in vergelijking met het kopen van een huis (waar farmaceuten elke verantwoordelijkheid voor bijwerkingen afwijzen!!)' (en zie de links in dat bericht)

'Coronavirus: paniek over de Deltavariant is onterecht en zwaar overdreven' (!!!!) En zie de links in dat bericht naar artikelen over de PCR test en de bezuinigingen op de gezondheidszorg >> die bezuinigingen zijn de reden voor de Coronamaatregelen, die werden immers genomen daar er te weinig ziekenhuisbedden, IC bedden en verpleegkundigen waren. Zoals ook in het bericht hierboven al gemeld: het aantal verpleegkundigen is als de bedden sterk teruggelopen door wanbeleid van de afbraakkabinetten Rutte 1, 2 en 3..... Zo waren er bij aantreden van Rutte 1 nog 2.200 IC bedden, dat was bij aanvang van de Coronacrisis teruggebracht naar 1.100 bedden..... Dus als je sterk bent benadeeld door de Coronamaatregelen, weet je wie hiervoor verantwoordelijk zijn!! Zie wat betreft dat bericht ook: 'Coronavirus: artsen willen via rechtszaak tegen de staat COVID-19 van A-lijst krijgen, daar het een griepvirus zou zijn 'De video die oorspronkelijk in het artikel was te zien is gecensureerd, tja je wilt natuurlijk niet dat de bevolking begrijpt hoezeer men werd en wordt belazerd......

'Met COVID-19 besmette zorgmedewerkers mogen ondanks symptomen gewoon doorwerken.......'

'Coronavirus: Fort Detrick eindelijk als verdachte van oorsprong aangemerkt'

'Vaccinatie tegen Spaanse Griep: miljoenen doden'

'COVID vaccinmakers: hoe betrouwbaar zijn deze farmaceuten' (en zie de links in dat bericht)

'COVID-19 vaccins en de bijwerkingen 'die zijn te verwaarlozen': een les van Pierre Capel, emeritus hoogleraar besmettingsleer en immunologie'

'COVID-19: gezonde mensen maken elkaar niet ziek'

'Coronabeslommeringen: ook na vaccinatie kan je het virus doorgeven, plus de zoveelste blunder van CDA minister de Jonge' Het na dit bericht gebrachte nieuws dat je niet besmettelijk bent na vaccinatie, is achteraf gebeleken grote onzin te zijn en zou gebaseerd zijn op een foute interpretatie van een bericht uit de VS, lijkt me ook logisch daar dr Fauci eerder al meldde dat gevaccineerden nog lang besmettelijk blijven en zich aan de Coronamaatregelen dienen te houden, terwijl de voormaligfe minister van Volksgezodnheid, CDA plork fde Jonge vorig jaar zelf toegaf dat gevaccineerden niet veilig zijn...... (zie de afbeelding met deze zwaar disfunctionerende kwezel in het blok met Pfizer links hierboven)

'Coronavirus, PCR test: leugens en onzin' (een artikel van Mario Ortiz Buijsse)

'Coronadoden? Agnes Kant (Lareb) geeft 'transparante duidelijkheid': deze 87 doden zijn te betreuren vanwege 'onderliggende klachten....'' (!!!!)

'Met COVID-19 besmette zorgmedewerkers mogen ondanks symptomen gewoon doorwerken.......' (!!!!)

'Coronavirus: alarmerend aantal dodelijke slachtoffers mRNA vaccins' (!!!!) (en zie ook de reactie onder dat bericht)

'Coronacrisis: Australische militairen moeten de straten en huizen van o.a. moslims in Sydney controleren' zie wat betreft Australië en de Coronamaatregelen ook:

'Zwangere vrouw in Australië gearresteerd voor het op Facebook posten van protest tegen de COVID-19 maatregelen'

'Premier Rutte, minister de Jonge, OMT en andere 'deskundigen' bezig met omzichtige voorlichting dat gevaccineerden besmettelijk blijven'

'COVID-19 vaccinaties: Hugo de Jonge met 10 km/u. uit de bocht, plus EU besluit: gedwongen vaccineren en discriminatie verboden' (!!!!)

'Frankrijk en Griekenland voeren vaccinatieplicht in voor verpleegkundigen en verzorgenden' (en zie de links in dat bericht!!)

'COVID-vaccin slachtoffers openen website na censuur van media die imago van vaccinmakers belangrijker achten dan volksgezondheid' (!!!!) (en zie de links in dat bericht!!)

-----------------------------------------------

Over de betrouwbaarheid van de farmaceuten (zie daarvoor ook het eerste blok met links over Pfizer): 'British Medical Journal eist onmiddellijke vrijgeving van alle gegevens over COVID-19 vaccins en onderzoek naar veiligheid'

'COVID-19 vaccin ontwikkeld in Texas: patentvrij voor de wereld' Terwijl de farmaceutische maffia (de grote farmaceuten) weigeren om hun recept gratis door te geven aan arme landen......

'COVID vaccinmakers: hoe betrouwbaar zijn deze farmaceuten'(!!!!)

'COVID-19: internist, cardioloog en epidemioloog wijst op gevaar van vaccins'

'Coronabeslommeringen van 'vreemde' maatregelen in Schotland tot een pleidooi door Universiteit van Oxford (NB medemaker AstraZeneca vaccin) ongevaccineerden uit te sluiten van het maatschappelijk leven'

'COVID-19: AstraZeneca schendt belofte geen winst te maken op door publiek gesubsidieerd vaccin en commentaar op de nieuwste maatregelen'

'Coronavaccinatie ook als je weet dat de fabrikant ernstige bijwerkingen niet uitsluit?' (!!!!) en zie:

'Coronavaccinatie in vergelijking met het kopen van een huis (waar farmaceuten elke verantwoordelijkheid voor bijwerkingen afwijzen!!)' (en zie de links in dat bericht)

'Coronavirus: Diederik Gommers (IC arts) zou het mooi vinden dat mensen worden ingeënt met het AZ vaccin nadat ze tekenden voor het risico dat ze lopen.....' (!!!!) (en zie de links in dat bericht!!) Een bericht gebracht nadat bleek dat veel mensen slecht reageerden op het AstraZeneca vaccin.... Eenzelfde eis overigens die de grote farmaceuten aan de landen hebben gesteld waar hun vaccin werd verspreid, dus geen gerechtelijke vervolging voor ernstige bijwerkingen op de korte, middellange en lange termijn, kortom zelfs de makers vertrouwen hun eigen vaccin niet......

'COVID-vaccin slachtoffers openen website na censuur van media die imago van vaccinmakers belangrijker achten dan volksgezondheid' (en zie de links in dat bericht!!) (!!!!)

'Coronadoden? Agnes Kant (Lareb) geeft 'transparante duidelijkheid': deze 87 doden zijn te betreuren vanwege 'onderliggende klachten....'' (!!!!)

'Coronabeslommeringen: AstraZeneca vaccin onder vuur >> universiteit van Oxford start opnieuw met angstzaaien voor het virus' (universiteit van Oxford heeft het vaccin gemaakt met AstraZeneca.......)

'Astra Zeneca volkomen veilig, uh nee niet voor ouderen, uh oh toch veilig voor ouderen, uh maar niet voor vrouwen onder de 60, uh ho even: toch wel, uhhhh.....'

-----------------------------------------

Wat betreft de betrouwbaarheid van de PCR test zie: PCR test in VS meer en meer onder vuur, ook de FDA en CDC willen ermee stoppen' en zie ook de volgende 5 links naar berichten over de PCR test en de waardeloze test op antilichamen:

'Coronavirus: PCR-test kan niet aantonen dat het virus aanwezig is in het lichaam, beweringen dat dit wel zo is zijn gelogen' In dat bericht zie je een groot aantal links naar oudere artikelen over het Coronavirus)

'CDC : COVID-19 testen kloppen in de helft van de gevallen niet: het virus is minder dodelijk dan gedacht ondanks de angszaaierij in de media'

'Uitvinder PCR test (algemeen gebruikt voor COVID-19): onbetrouwbaar als medische test' Hier een video over deze zaak met de uitvinder en de daarvoor met de Nobelprijs beloonde Kary Mullis:

'Coronavirus, PCR test: leugens en onzin' Een artikel van Mario Ortiz Buijsse.

'Epidemioloog Rosendaal (LUMC) 40% van de sneltesten onbetrouwbaar en dat op basis van de al niet werkende PCR test!!'

Ook de test op antilichamen klopt niet, dit is een test voor mensen die het virus onder de leden hebben gehad (!!!!): 'COVID-19 testen op antilichamen van o.a. Roche, Quest en Abbott zijn waardeloos'

zaterdag 12 maart 2022

Oekraïne: de nazistrijders van de VS

De denazificatie van Oekraïne, aangekondigd door de Russische president Putin, werd in het westen smalend afgedaan als propaganda om de militaire inval in dat land te legitimeren, ook het Witte Huis deed dit af als een belachelijke opmerking..... Terwijl het bekend is dat de VS Oekraïense neonazi bataljons heeft getraind, zelfs tot de inval van Rusland (ook Canadese wapeninstructeurs hebben zich hieraan schuldig gemaakt.....).....

Voorts is het zeker dat de VS middels de CIA de staatsgreep tegen de democratische gekozen president Janoekovytsj heeft betaald (met 4 miljard dollar), de opstand die tot de staatsgreep leidde heeft georganiseerd en de uiteindelijke coup heeft georganiseerd en geregisseerd (waarbij men gebruikmaakte van neonazi-groeperingen), inclusief het betalen van huurmoordenaars die politieagenten en burgers doodschoten op het Maidanplein in Kiev (volgens sommigen waren deze moordenaars ook neonazi's en dat zou me in het geheel niet verbazen).

Na de coup heeft de VS de corrupte neonazi Porosjenko aangesteld als 'interim president', vroeger noemden we dit beest bij de naam: juntaleider (dat 'interim president' moest de smerige lading >> een bloedige staatsgreep dan ook dekken en daarmee legitimeren.....)

De neonazi's hebben daarna de illegale regering gecontroleerd en daarnaast kritische journalisten en politici belaagd dan wel zelfs vermoord..... Van vrije verkiezingen was en is geen sprake in Oekraïne, daar partijen zijn verboden die op grote steun kunnen rekenen van bijvoorbeeld mensen van Russische komaf..... Weet niet hoe jij hierover denkt, maar het uitsluiten van politieke partijen, geeft m.i. aan dat je met een dictatuur te maken hebt, zelfs met een fascistische dictatuur......

In het hierna weergegeven artikel van Mike Whitney, eerder gepubliceerd The Unz Review (ik nam het over van Information Clearing House), gaat deze verder in op het fascistische gehalte van Oekraïne en hoe de VS daar gebruik van heeft gemaakt en nog steeds maakt. Onder andere aandacht in dat artikel voor het feit dat het bureau van de Hoge Commissaris voor Mensenrechten (OHCHR) al in 2016 het neonazi-bataljon Azov, destijds al 'bevorderd' tot een officieel regiment van het Oekraïense leger, zich schuldig maakte aan oorlogsmisdaden als grootschalig plunderen, onwettige gijzeling en marteling (het noemen van moord op tegenstanders ging de OHCHR blijkbaar te ver, immers destijds had dit bataljon zicht al schuldig gemaakt aan het vermoorden van een groot aantal mensen.......)

Hier nog een paar 'opmerkelijke zaken' van de laatste paar dagen:

Gisteren vergistte een verslaggever van WDR 5 zich danig en week af van het platgetreden pad dat Rusland de door haar zelf ingestelde corridors onder vuur neemt, volgens deze figuur worden deze corridors onder vuur genomen, omdat Rusland ze niet afspreekt met de Oekraïense autoriteiten...... Kortom deze sufferd gaf toe dat het Oekraïense leger deze corridors onder vuur neemt!!

Men maakt zich in de reguliere westerse media en politiek druk over aanvallen van burgerdoelen door Rusland. Voor zover dat ook maar iets met de waarheid te maken heeft, immers neonazi-bataljons als Azov hebben er totaal geen moeite mee om de eigen burgers aan te vallen en de schuld daarvoor in de schoenen van Rusland te schuiven..... Wat betreft het aanvallen van burgerdoelen, melden westerse media NB keer op keer over burgers die hun appartementencomplexen veranderen in militaire aanvalsposten, dit door opgeworpen versperringen, het maken van tankvallen en versterkingen van die complexen om van daaruit Russen aan te kunnen vallen, dit zou volgens zeggen in alle Oekraïense steden het geval zijn...... Ofwel hoe kan je van een woonwijk een militair doel maken??!!!

Dan te bedenken dat men in de VS de stormloop op het Capitol van 6 januari 2021 toeschrijft aan nazi en ander tuig, terwijl het Witte Huis, het Pentagon en de CIA er geen moeite mee hebben om Oekraiense neonazi's te trainen en te bewapenen als ze maar tegen Russen of mensen van Russische komaf vechten....... Hoe hypocriet en ziek wil je het hebben??

Hare kwaadaardigheid minister Kaag misbruikt de situatie in Oekraïne om te pleiten voor het inleveren van Nederlandse soevereiniteit ten gunste van de EU (ofwel van de grote EU staten Frankrijk, Duitsland, Polen e.a., echter waar de eerste 2 verreweg de belangrijkste zijn....).... Vanmorgen hoorde ik in MAX Nieuwsweekend de potsierlijke kwast en meer dan waardeloze 'politiek deskundige' Kees Boonman* stellen dat het grootste deel van de Nederlanders achter het inleveren van soevereiniteit zou staan. 'Iedereen zou dit wel begrijpen' gezien de 'Russische agressie', aldus de fantast, die er geen moeite mee heeft als de VS weer eens een land naar god bombardeert..... Uiteraard heeft deze waardeloze sufferd geen begrip voor de positie van Rusland dat bijna het jaarrond agressieve NAVO oefeningen ziet langs haar westgrens en territoriale wateren (zelfs gericht op het binnenvallen van Russische grondgebied)...... Of wat dacht je van het zogenaamde VS raketschild in Polen en Roemenië, waarvan de VS de raketten in een mum van tijd kan veranderen in aanvalsraketten met al aanwezige meerdere kernkoppen, waarmee de VS grote Russische steden kan vernietigen en dat over afstanden die waren verboden in het INF-verdrag (niet voor niets ook dat de VS dit verdrag heeft opgezegd, zogenaamd vanwege een nieuwe generatie Russische kernraketten, die de VS op meerdere uitnodigingen van Rusland weigerde te inspecteren, inspecties zodat de VS kon zien dat deze raketten het INF-verdrag niet schenden >> ook al een zaak waarvoor de westerse politici en media geen aandacht hadden of hebben.....)

In het WDR 5 nieuws van vanmiddag o.a. het bericht dat de Duitse autoriteiten ongerust zijn over de aanvallen op mensen van Russische komaf, aanvallen op hun winkels en zelfs de aanvallen waar kinderen van deze mensen op school mee te maken hebben....... Ofwel dezelfde autoriteiten hebben Rusland uit en te na gedemoniseerd, waarbij men de Russische burgers heeft verweten niet tegen de Russische acties in Oekraïne te hebben uitgesproken, ofwel dan moet je wel achter die acties staan en ben je volgens deze autoriteiten blijkbaar vogelvrij verklaard.......

Lees het artikel van Whitney en geeft het ajb door, de hoogste tijd dat het westen stopt met haar vreselijke anti-Russische propaganda en dat deze wordt doorgeprikt, zonder dat de westerse politiek en reguliere media ook maar met één letter wijzen op de terechte angsten van Rusland en haar wil om Oekraïne te denazificeren........ Het is in het westen al zo zot dat het neonazi-bataljon Azov openlijk mag worden geroemd, terwijl de ploerten van dat bataljon zich achter de nazi-Duitse aanval tegen Rusland hebben geschaard tijdens de Tweede Wereldoorlog (WOII) en de leden van dat bataljon zich bedienen van nazi-emblemen en geen moeite hebben met de Hitler groet...... Vergeet niet dat de strijd van Rusland tegen nazi-Duitsland aan 20 miljoen Russen het leven heeft gekost......

Je kan het volgende artikel vertalen met de vertaalapp van Information Clearing House, te vinden onder het volgende artikel, klik dan op 'dutch', of met deze vertaalapp, die snel werkt en de vertaling is van een redelijk goede kwaliteit. Kopieer het artikel en plaats het links in de app, je ziet rechts Italiaans staan als je daar op klikt kan je kiezen voor Nederlands.

Uncle Sam's Nazi Warriors

By Mike Whitney

March 11, 2022: Information Clearing House --

“I have spoken with my Western colleagues about denazification. They say:” What’s the problem? You also have radical nationalists, don’t you?” Yes, we do, but we don’t have them in our government like Ukraine. And we don’t have thousands of people marching in the streets with torches and swastikas like Nazi Germany in the 1930s? And we don’t praise the men who killed Russians, Jews, and Poles during the war. But in Ukraine, they do.” Vladimir Putin, Russian President

The United States has been arming and training far-right militants that are the ideological descendants of Nazi war criminals that were directly involved in the mass-extermination of Jews, Slavs and Gypsies during the Second World War. These Ukrainian storm troopers are among the most vicious and malignant combatants Washington has ever employed to implement its foreign policy agenda. Naturally, Washington sees these fascist-zealots as mere pawns in its proxy war on Russia. Even so, the ‘alliance of convenience’ does not diminish the fact that Uncle Sam is now in bed with right-wing militants whose spiritual leader, Adolph Hitler, was responsible for the deaths of tens of millions of people as well as the destruction of large parts of Europe and Russia. Check out this clip from an article titled “Can Ukraine have a ‘Nazi problem’ with a Jewish president?:

“Ukraine really does have a far-right problem, and it’s not a fiction of Kremlin propaganda. And it’s well past time to talk about it,” explained journalist and expert on the Ukrainian far right, Michael Colborne.

The most known neo-Nazi group on Ukraine’s far right is the Azov movement. The movement grew out of the Azov Regiment (originally a Battalion), formed in the chaos of war in early 2014.

It was formed by a “ragtag group of far-right thugs, football hooligans and international hangers-on, including dozens of Russian citizens,” said Colborne, who wrote a book on the movement.”(“Can Ukraine have a ‘Nazi problem’ with a Jewish president?”, Jewish Unpacked)

While Russian President Vladimir Putin is committed to removing Ukraine’s Nazis from power, it is uncertain how he will do so. Self-identified fascists now hold positions of authority in the military, the government and the Security Services. They have also been the driving force behind the 8 year-long siege of the Donbass region in east Ukraine that is mainly inhabited by ethnic Russians. The militants’ hatred for their Slavic brothers suggests that Hitler’s racial theories are being ruthlessly applied in 21st Century Europe. Here’s an excerpt from an article at The Saker Blog:

“Since the Western-backed coup in Kiev in 2014, political organizations associated with neo-Nazis infiltrated Ukrainian mainstream politics as the Ukrainian government sent troops to try to crush the Donbass uprisings by force.

As Ukraine waged war against breakaway forces in the Donetsk and Lugansk People’s Republics, the Neo-Nazi Groups in Ukraine gained notoriety for their belligerent rhetoric towards the population of the country’s east, as well as for eagerly participating in the civil war….

The (Azov Battalion’s) first commander was right-wing nationalist Andriy Biletsky, who led the paramilitary national socialist group called “Patriot of Ukraine” and was the founder of a neo-Nazi group, the Social-National Assembly (SNA) in 2008. In 2010, Biletsky, a former parliamentarian, apparently said that Ukraine was meant to “lead the white races of the world in a final crusade … against Semite-led Untermenschen (subhumans) ”by reports in a spate of Western mainstream outlets.” (“Ukrainian bad guys and a fair Russian response“, Batko Milacic for the Saker Blog)

Readers should take a minute to savor Washington’s duplicity on this matter, after all, while the Biden administration and the entire MSM was denouncing the January 6 protestors as “racists” and “white supremacists”, the US government was busy arming and training “white crusader” Nazis to carry out its war on Russia. What’s that all about? If there was an Academy Award for hypocrisy, Uncle Sam would be the hands-down favorite. Here’s more from the same piece:

“Azov took part in subsequent hostilities in Donbass and was incorporated into the National Guard of Ukraine in November 2014, although its members continued to wear neo-Nazi and SS-like symbols and regalia and openly express neo-Nazi views. Their logo echoes the Wolfsangel, one of the original symbols used by the 2nd SS Panzer Division Das Reich. Representatives of the Azov Battalion, however, have claimed their symbol is an abbreviation for the slogan “National Idea” in Ukrainian.

Ukrainian authorities did not bother to conceal the fact that in 2014, Azov comprised neo-Nazi-leaning volunteers from countries such as Sweden, Italy, France, Belarus, Canada, and Slovenia.

Despite the adoption of the 2015 Minsk Accords that were aimed at ending the civil war by reintegrating the Donbass into Ukraine in exchange for constitutionally-guaranteed autonomy, Kiev refused to implement a peace deal. Azov members took an active part in Donbass hostilities.

In 2016, the Office of the UN High Commissioner for Human Rights (OHCHR) accused the Azov Battalion, officially upgraded to a regiment in January 2015, of committing war crimes such as mass looting, unlawful detention, and torture. Currently, the Azov “Special Operations Detachment” is engaged in the Ukrainian army’s counter-reconnaissance and special weapons operations.

The Russian Investigative Committee has opened a criminal case against a number of fighters from Azov units for crimes such as kidnapping, torture, use of prohibited means, and methods of warfare.” (“Ukrainian bad guys and a fair Russian response”, Batko Milacic for the Saker Blog)

Again, these are not your garden-variety, right-wing militants. These are full-fledged, battle-hardened Nazi storm troopers that have engaged in all-manner of illegal and sadistic activities including “the mass killing of prisoners, the concealment of corpses in mass graves and the systematic use of physical and psychological torture techniques.” And while they are lavishly supported by the United States, they oppose everything that America claims to stand for. They are universally opposed to liberal democracy, parliamentary government and racial equality. Instead, they advocate social regimentation, autocratic rule and glorification of the state. Race is very much at the core of Nazi Doctrine. (which may explain the animus these fascist groups have for the ethnic Russians in the east.) A few quotes from Hitler’s manifesto Mein Kampt help to illustrate this point:

“A stronger race will drive out the weaker ones, for the vital urge in its ultimate form will break down the absurd barriers of the so-called humanity of individuals to make way for the humanity of nature which destroys the weak to give their place to the strong.”

“Blood sin and desecration of the race are the original sin of this world and the end of a humanity that surrenders to it.” (“Adolf Hitler, Quotes on Race”, quotetab)

The above quotes provide a window into the ideology that was used to justify a world war against “inferior people” who were seen as expendable in the eyes of their Aryan overlords. Why– you may ask– is the US supporting the adherents of this same fiendish dogma in Ukraine today?

We can’t answer that, but here’s more background from an article by Monseigneur Carlo Maria Vigano:

“Neo-Nazi movements engaged in military and paramilitary actions operate freely in Ukraine, often with the official support of public institutions. These include the following: Stepan Bandera’s Organization of Ukrainian Nationalists (OUN), a movement with a Nazi, anti-Semitic and racist matrix already active in Chechnya and which is part of the Right Sector, an association of far-right movements formed at the time of the Euromaidan coup in 2013/2014; the Ukrainian Insurgent Army (UPA); the UNA/UNSO, paramilitary wing of the far-right political party Ukraine National Assembly; the Korchinsky Brotherhood, which offered protection in Kiev to ISIS members; Misanthropic Vision (MD), a neo-Nazi network spread across 19 countries that publicly incites terrorism, extremism and hatred against Christians, Muslims, Jews, Communists, homosexuals, Americans and people of color.

It should be remembered that the government has given explicit support to these extremist organizations both by sending the presidential guard to the funerals of their representatives, as well as by supporting the Azov Battalion, a paramilitary organization that is officially part of the Ukrainian Army under the new name of Azov Special Operations Regiment and organized into the National Guard. ..

In March 2015, Ukrainian Interior Minister Arsen Avakov announced that the Azov Battalion would be one of the first units to be trained by US Army troops, as part of their Operation Fearless Guard training mission. … “We have been training these guys for eight years now. They are really good fighters. That’s where the Agency’s program could have a serious impact.” (“Declaration of Msgr. Carlo Maria Viganò on the Russia-Ukraine Crisis”, marcotosatti.com)

Vigano is right, the US has been providing combat training to Ukrainian Nazis and other far-right groups in secret camps since 2015. These ultra nationalist militias will now pass along these same skills to tens of thousands of other like-minded militants increasing the global spread of fascism by many orders of magnitude. Here’s more from an article at Jacobin Magazine:

“Not just the Ukrainian far right, but neo-fascist forces from all over the world, including the US and Europe, will now receive combat experience with the most advanced weapons in the world. They will also be able to continue developing their international networks, to which the Ukrainian far right, and especially the Azov Battalion, have long been central…

… since 2015, the CIA has been secretly training forces in Ukraine to serve as “insurgent leaders,” in the words of one former intelligence official, in case Russia ends up invading the country. Current officials are claiming the training is purely for intelligence collection, but the former officials Yahoo! spoke to said the program involved training in firearms, “cover and move,” and camouflage, among other things.

Given the facts, there’s a good chance that the CIA is training actual, literal Nazis as part of this effort. The year the program started, 2015, also happened to be the same year that Congress passed a spending bill that featured hundreds of millions of dollars’ worth of economic and military support for Ukraine… (“The CIA May Be Breeding Nazi Terror in Ukraine”, Branko Marcetic, Jacobin Magazine)

But why has the United States gone to so much trouble to arm and train these combatants when it appears that the Russian army is clearly going to win the war?

The plan to defeat Russia was never intended to succeed in the initial phase of the conflict, but to lay the groundwork for a bloody and protracted insurgency fought by these same CIA-trained paramilitaries who now act as Uncle Sam’s Nazi warriors. Here’s the story from Yahoo News:

“The CIA is overseeing a secret intensive training program in the U.S. for elite Ukrainian special operations forces and other intelligence personnel, according to five former intelligence and national security officials familiar with the initiative. The program, which started in 2015, is based at an undisclosed facility in the Southern U.S., according to some of those officials….

The training, which has included “tactical stuff,” is “going to start looking pretty offensive if Russians invade Ukraine,” said the former official. One person familiar with the program put it more bluntly. “The United States is training an insurgency,” said a former CIA official, adding that the program has taught the Ukrainians how “to kill Russians.”

Though the agency’s paramilitary resources have been otherwise stretched thin in Afghanistan and on other counterterrorism missions, the U.S.-based training program has been a “high priority” for the CIA since its Obama-era inception, said the former senior intelligence official…. The Biden administration has reportedly assembled a task force to determine how the CIA and other U.S. agencies could support a Ukrainian insurgency, should Russia launch a large-scale incursion.

“If the Russians invade, those [graduates of the CIA programs] are going to be your militia, your insurgent leaders,” said the former senior intelligence official. “We’ve been training these guys now for eight years. They’re really good fighters. That’s where the agency’s program could have a serious impact.”

Both U.S. and Ukrainian officials believe that Ukrainian forces will not be able to withstand a large-scale Russian incursion, according to former U.S. officials. But representatives from both countries also believe that Russia won’t be able to hold on to new territory indefinitely because of stiff resistance from Ukrainian insurgents, according to former officials.

If the Russians launch a new invasion, “there’s going to be people who make their life miserable,” said the former senior intelligence official. The CIA-trained paramilitaries “will organize the resistance” using the specialized training they’ve received.

“All that stuff that happened to us in Afghanistan,” said the former senior intelligence official, “they can expect to see that in spades with these guys.” (“CIA-trained Ukrainian paramilitaries may take central role if Russia invades”, Yahoo News)

Let’s summarize:

The United States has been arming and training Ukrainian fascist combatants in secret locations.
The CIA training program began in 2015 which suggests there must have been a plan for goading Russia into invading. Nothing would have been left to chance. Strategic planners must have settled on what provocations they would use. (like the threat of NATO membership)
Official Washington never thought the Ukrainian army could prevail against a conflict with the Russian Army, which suggests that the media’s stories about “the brave Ukrainian resistance” are reckless propaganda designed to garner greater public support.
The country of Ukraine and the Ukrainian people are of no interest to the United States. Ukraine is only valuable in as much as it provides a staging ground (and the manpower) for Washington to prosecute a war against Russia.
The clear strategic objective of the CIA program is to create an “Afghanistan-type” quagmire for Russia that will deplete its resources, inflict massive reputational damage, and kill as many Russian servicemen as possible.
The ultimate goal of the CIA-generated insurgency is to destroy the Russian economy, isolate the Russian leadership, and send home as many Russian boys in body-bags as possible in order to affect a regime change that will replace arch-rival Putin with a compliant stooge like Ukrainian Puppet Zelensky.
All the evidence suggests that the developments on the ground– including the luring of Russian troops into Ukraine– is part of a long-standing strategic plan to prevent the economic integration of Russia and Europe in order to control China’s development and preserve US hegemony into the next century. Thus, current US foreign policy can be summarized in just 10 words:

“We’ll deal with Russia first, then move on to China.

Important Notes:

1– Must watch– Tucker Carlson, America’s best essayist, “We are at war with Russia”

2– Must watch –

Prof. John Mearsheimer explains the crisis in Ukraine the crisis in Ukraine (with Ray McGovern), Consortium News

Click Here To Support Information Clearing House

Your support has kept ICH free on the Web since 2002.

Click for Spanish, German, Dutch, Danish, French, translation- Note- Translation may take a moment to load.

==========================================

* Boonman ziet het vooral als zijn taak om de disfunctionerende VVD premier Rutte en diens kabinetten te prijzen en dat durft zich ook nog journalist te noemen.......

--------------------------------------------------

Zie ook: 'Oekraïne: Facebook en Instagram staan oproepen tot moord op Russen toe'

'Putin wast het westen nog eens de oren'

'Oekraïense democratie een schijnvertoning, plus het tegenhouden van gekleurde vluchtelingen door de politie en douane van Oekraïne' (!!!!)

'Oekraïne: de strijd tegen de waarheid over de bloedige VS terreur plus de enorme westerse hypocrisie'

'Oekraïne en 'het truckers protest' tegen COVID-maatregelen in Canada van fundamentalistisch religieus rechts, racisten en ander tuig? Eén grote leugen!!'

''Russische propaganda': het laatste excuus voor nog meer 'democratische censuur' op de sociale media'

'Oekraïne: belangrijke punten die niet mogen worden vergeten, ondanks de propagandawals die over ons heen wordt gereden'

'Oekraïne: wie jarenlang een wereldmacht tart moet niet opkijken als deze uiteindelijk optreedt' (!!!!)

'Oekraïne: Rusland erkent Luhansk en Donetsk, de westerse wereld alweer hypocriet op de kop' En zie de links in dat bericht!!

'Westerse Oekraïne leugens'

'Oekraïne: Russische 'propaganda' is informatie die VS propaganda weerlegt'

'Oekraïne: waarom niet de reguliere media direct laten leiden door de CIA en is de VS wellicht bezig met de voorbereiding van een aanval op Rusland'

'De Krim het echte verhaal: geen annexatie maar de vrijwillige aansluiting bij Rusland, zelfs Oekraïners stemden voor' (!!!!)

'Propaganda niet alleen voor oorlogsvoering maar levensbepalend zoals die voor het Verdrag van Maastricht'

'Generaal Stoss: VS ziet een 'epische nucleaire dreiging' van China en Rusland' (!!!!)

'Oekraïne crisis: het feit dat het westen dit sprookje in de wereld hielp 'heeft voorkomen' dat een Russische inval plaatsvond.......' (en zie de links in dat bericht!!)

'BREKEND NIEUWS: Oekraïne crisis: de CIA heeft Disney overgenomen: beweringen zonder enig bewijs dat Rusland een 'false flag video' gebruikt zijn 'waar....'' (en zie de links in dat bericht!!)

'Nederlandse marine doet mee aan VS oorlogshitserij tegen China' (en zie de links in dat bericht!!)

'Oekraïne: het conflict berust puur op aannames die werden en worden gelanceerd door de VS en haar NAVO-partners' (en zie de links in dat bericht!! Waarvan je de eerste hieronder vindt)

'Oekraïne: westerse 'stabilisatie van het conflict': levering van wapens, straaljagers en troepen'

'VS begint 'troll farm', alsof Hollywood en de massamedia al niet genoeg VS propaganda maken..........' (en zie de links in dat bericht!!)

'Strijd opgelaaid in Oost-Oekraïne tussen het leger en 'door Rusland gesteunde rebellen', aldus BBC World Service' (en zie de links in dat bericht!!)

'Tony Blinken heeft de Oekraïense president Zelensky de wacht aangezegd: zijn land is officieel een VS kolonie' (!!!!)

''Porosjenko (Oekraïne) roept de NAVO op tot oorlog tegen Rusland'

'Election ploy? Poroshenko declares martial law in Ukraine after Kerch standoff'

'VS senator Rand Paul stelt n.a.v. NAVO-top dat men de zaak moet bekijken vanuit het Russische perspectief'

'Putin en Trump halen spanning uit de lucht >> de westerse wereld schreeuwt moord en brand......'

'Afspraken met de VS maken? Voor je het weet heb je te maken met een 'verspreking' van de president..... ha! ha! ha! ha! ha!'

'Oekraïne, wat de reguliere (massa-) media, 'deskundigen' en politici u niet vertellen over dit door een junta geregeerd land' (!!!!)

'Oekraïne, Georgië en Moldavië hebben oud bondgenootschap doen herleven, in voorbereiding op NAVO lidmaatschap en verdere actie tegen Rusland........'

'De Krim, Georgië en Syrië >> de anti-Russische propaganda.....'

'Oekraïne en NAVO bezig met uitlokking WOIII.........

'VS levert neonazi-leger Oekraïne voor 250 miljoen dollar aan wapens'

Ukraine is ready for NATO membership Foto van het neonazi-bataljon Azov in Oost-Oekraïne, bataljons als deze hebben de laatste 8 jaar de steden en dorpen van de zich van Oekraïne afgescheiden staatjes Luhansk en Donetsk gebombardeerd, gelukkig zijn ze allesbehalve goed in dat bombarderen, al hebben ze alsnog veel slachtoffers gemaakt onder burgers in die staatjes.... Zie ook de NAVO vlag naast een neonazi vlag....... Voor de omgekomen neonazi's hebben onze zwaar disfunctionerende VVD premier en aartsleugenaar Rutte en CDA kluns Hoekstra die minister van BuZa mag spelen in het kabinet Rutte 4, een krans gelegd in Kiev, zie de foto die hieronder is te vinden.

'Oekraïne het toneel van grootschalige luchtmachtoefeningen met VS en NAVO, naast een enorme militaire VS/NAVO oefening in Noorwegen'

'Geert Jan Hahn en zijn 'deskundige' gekleurde kijk op Oekraïne........ AAJAAAJAAAJ!!!' (26 februari 2015) Hahn was destijds de Oost-Europa deskundige van BNR wat hij nu weer is, ondanks zijn enorme blunders die hij destijds en ook nu weer maakt......

'David Jan Godfroid bakt ze bruin vanuit Oekraïne.......' Godfroid was/is de Oost-Europa deskundige van de zogenaamd onafhankelijke NOS.......

'NAVO beschuldigt Rusland alweer van meevechten met- en wapenleveranties aan opstandelingen Oost-Oekraïne'

---------------------------------

Hier nog wat links naar berichten over de oneindige VS terreur: 'VS vermoordde meer dan 20 miljoen mensen sinds het einde van WOII........' Dit tot het jaar 2000, wat betreft deze eeuw zijn er intussen meer dan 5 miljoen moorden aan toegevoegd, moorden begaan door de VS en NAVO-lidstaten, inclusief Nederland (waar terreurorganisatie NAVO altijd onder militair opperbevel stond en staat van de VS...).... Ongelofelijk dat men nooit zal beginnen over het nemen van sancties tegen de VS, terwijl dat land oneindig veel meer ellende en zwaar bloedvergieten over de aarde heeft gebracht en brengt dan Rusland.....

'VS buitenlandbeleid sinds WOII: een lange lijst van staatsgrepen en oorlogen..........'

'List of wars involving the United States'

'CIA 70 jaar: 70 jaar moorden, martelen, coups plegen, nazi's beschermen, media manipulatie enz. enz.........' (!!!!)

'9/11: de reden voor twintig jaar westerse terreur o.l.v. de VS waarbij meer dan vijf miljoen mensen werden vermoord' (en zie de links in dat bericht!!)

'CIA rekruteert folteraars met een beroep op vrouwenemancipatie: een fikse rel in de VS'

'Michael Hayden (ex-CIA en generaal b.d.): niets mis met martelingen door Gina Haspel.....'

'US Airstrikes Killing Hundreds of Civilians in Syria’s Raqqa'

'VN waarschuwt de VS voor het maken van een onacceptabel aantal Syrische burgerslachtoffers met haar bombardementen.......' Waar de VS zich niets van heeft aangetrokken......

'VS gaf sinds 2001 meer dan 5,9 biljoen dollar uit aan (illegale) oorlogen, ofwel: $ 5,933.000.000.000.......' (tot 2018.....)

'VS is grootste producent van vluchtelingen, aldus VN rapport..........' (!!!!) (en zie de links in dat bericht!!)

'VS subsidiëring van neonazi's in Oekraïne, neonazi's die ook fascisten uit de VS trainen......' (!!!!) Lees dat bericht mensen, weet je meteen dat de EU en de NAVO neonazi's steunen met hun geldelijke en wapenhulp aan dat land!! (voor de NAVO trouwens de normaalste zaak van de wereld: dat steunen van fascisten.....) En dan te bedenken dat premier Rutte en minister van Buitenlandse Zaken Hoekstra onlangs een krans hebben gelegd bij een monument voor met name omgekomen neonazi's...... (op 8 februari 2022 heb ik de opmerking over de kranslegging door Rutte en Hoekstra aan deze link toegevoegd) Hier een foto van dit walgelijk gebeuren met aartsleugenaar Rutte ofwel Pinokkio 2.0:

'VS verwijt Iran nucleaire chantage, chantage waar de VS zichzelf schuldig aan maakt' (en zie de links in dat bericht!!)

En nogmaals: het is de allerhoogste tijd dat journalist Julian Assange wordt vrijgelaten uit de smerige isolatiefolter waarin hij nu al bijna 3 jaar volkomen onterecht vastzit voor het openbaren van zware oorlogsmisdaden begaan door de VS (toegegeven in officiële gelekte documenten van de VS!!!)....... Het is zelfs de taak van een ieder om zware misdaden aan te geven!!! Deze documenten plus beeldmateriaal zijn te vinden in WikiLeaks!!

De Azijnpisser

Geen evolutie en ecolutie zonder revolutie!

Albert Einstein:

zondag 13 maart 2022

Pfizer vaccin tast DNA van de lever aan

Intracellular Reverse Transcription of Pfizer BioNTech COVID-19 mRNA Vaccine BNT162b2 In Vitro in Human Liver Cell Line

Abstract

1. Introduction

2. Materials and Methods

2.1. Cell Culture

2.2. REAL-TIME RT-QPCR

2.3. Immunofluorescence Staining and Confocal Imaging

2.4. Genomic DNA Purification, PCR Amplification, Agarose Gel Purification, and Sanger Sequencing

Statistics

2.5. Ethical Statements

3. Results

3.1. BNT162b2 Enters Human Liver Cell Line Huh7 Cells at High Efficiency

3.2. Effect of BNT162b2 on Human Endogenous Reverse Transcriptase Long Interspersed Nuclear Element-1 (LINE-1)

3.3. Detection of Reverse Transcribed BNT162b2 DNA in Huh7 Cells

4. Discussion

5. Conclusions

Supplementary Materials

Author Contributions

Funding

Institutional Review Board Statement

Informed Consent Statement

Data Availability Statement

Acknowledgments

Conflicts of Interest

References

'Coronavaccinatie ook als je weet dat de fabrikant ernstige bijwerkingen niet uitsluit?' (!!!!) en zie:

zaterdag 12 maart 2022

Oekraïne: de nazistrijders van de VS

Vertaling: for translation select your language

Let wel, dit onderdeel werkt niet perfect! Je kan ook op de 'labels' onder de berichten klikken.

De Azijnpisser nu ook op het web

Blogarchief

Muziek 'likes' van mijn lieve zoon Loek via Spotify en mijn 'likes' op Spotify, Shazam en YouTube

TABAKSACCIJNS EN CORRUPTIE

Muziektip van uw Azijnpisser bij de koppen en aanhangsels van Wilders en andere fascisten

Atoom-stroom

Hans Crombag in Oba Live (Radio 5) vrijdag 26 maart 2010

Pagina's

De Azijnpisser in beeld

Over mij

Mijn lijst met blogs

woensdag 10 februari 2010

Start